View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13311_low_13 (Length: 207)
Name: NF13311_low_13
Description: NF13311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13311_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 15 - 153
Target Start/End: Original strand, 5073912 - 5074050
Alignment:
| Q |
15 |
agcagagacatgtaatatgatgatgaaaaaatggtaacatatgaatttgaaggaagaagacatggtttattttggtgtgtgagtgtgaagaattatgaga |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5073912 |
agcaaagacatgtaatatgatgatgaaaaaatggtaacatatgaatttgaaggaagaagacatggtttgttttggtgtgtgagtgtgaagaattatgaga |
5074011 |
T |
|
| Q |
115 |
tgaaggttgatgattcaagcataacactaaccgtaaatg |
153 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5074012 |
tgaaggttgatgattgaagcataacactaaccgtaaatg |
5074050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 34595400 - 34595476
Alignment:
| Q |
15 |
agcagagacatgtaatatgatgatgaaaaaatggtaacatatgaatttgaaggaagaagacatggtttattttggtg |
91 |
Q |
| |
|
|||| ||||||||||||||||||| || |||||||||||||||||||||||| ||||||| || ||| |||||||| |
|
|
| T |
34595400 |
agcaaagacatgtaatatgatgataaataaatggtaacatatgaatttgaagtaagaagaagtgatttgttttggtg |
34595476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 21 - 91
Target Start/End: Original strand, 33552626 - 33552696
Alignment:
| Q |
21 |
gacatgtaatatgatgatgaaaaaatggtaacatatgaatttgaaggaagaagacatggtttattttggtg |
91 |
Q |
| |
|
|||||||||||||||||| || ||| | || ||||||||||||||| ||||||| || |||| |||||||| |
|
|
| T |
33552626 |
gacatgtaatatgatgataaataaaagatagcatatgaatttgaagaaagaagatatagtttgttttggtg |
33552696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 43 - 91
Target Start/End: Complemental strand, 28361200 - 28361152
Alignment:
| Q |
43 |
aaatggtaacatatgaatttgaaggaagaagacatggtttattttggtg |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28361200 |
aaatggtaacatatgaatttgaaggaagaagacatggtttgttttggtg |
28361152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 15 - 82
Target Start/End: Complemental strand, 31558406 - 31558339
Alignment:
| Q |
15 |
agcagagacatgtaatatgatgatgaaaaaatggtaacatatgaatttgaaggaagaagacatggttt |
82 |
Q |
| |
|
|||| ||||| |||| |||||||| || |||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
31558406 |
agcaaagacaagtaacatgatgataaataaatggtaacgtatgaatttgaaggaagaaggcatggttt |
31558339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 91
Target Start/End: Complemental strand, 12890664 - 12890616
Alignment:
| Q |
43 |
aaatggtaacatatgaatttgaaggaagaagacatggtttattttggtg |
91 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| || ||| |||||||| |
|
|
| T |
12890664 |
aaatggtaatatatgaatttaaaggaagaagacgtgatttgttttggtg |
12890616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University