View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13311_low_8 (Length: 242)

Name: NF13311_low_8
Description: NF13311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13311_low_8
NF13311_low_8
[»] chr4 (1 HSPs)
chr4 (32-201)||(39795121-39795291)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 32 - 201
Target Start/End: Complemental strand, 39795291 - 39795121
Alignment:
32 gatgataatgtgttatcccatatcctatgaatgaaaaaagataaaagagagatattagagaaaatgtgaaacatctttctctaaacaaaattagaaccgg 131  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
39795291 gatgataatgtgttatcccatatcctatgaatgaaaaaagataaaagagagaaattagagaaaatgtgaaacatctttctctaaacaaaattagaaccgg 39795192  T
132 ctgcaaattttacgctattcgtgaggtgagaaatgaaatcgattcttttacaaactaaa-taataaacccc 201  Q
    |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||    
39795191 ctgcaaattttaggctattcgtgaggtaagaaatgaaatcgattcttttacaaactaaattaataaacccc 39795121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University