View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13312_low_1 (Length: 671)

Name: NF13312_low_1
Description: NF13312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13312_low_1
NF13312_low_1
[»] chr1 (2 HSPs)
chr1 (18-90)||(52002537-52002609)
chr1 (9-90)||(5174725-5174806)


Alignment Details
Target: chr1 (Bit Score: 57; Significance: 2e-23; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 52002537 - 52002609
Alignment:
18 gaaaagaagtgacatatggaatatgcttataatacttggttaaggacgaaaaacaaagttcgattgctgatga 90  Q
    ||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||    
52002537 gaaaagaagagacgtatgcaatatgcttataatacttggttaaggacgaaaaacaaagttcaattgctgatga 52002609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 9 - 90
Target Start/End: Original strand, 5174725 - 5174806
Alignment:
9 aacacagacgaaaagaagtgacatatggaatatgcttataatacttggttaaggacgaaaaacaaagttcgattgctgatga 90  Q
    |||||| |||||||||||||| ||||||||||||||||| ||| ||||||||||| |||||||||| ||| |||||||||||    
5174725 aacacaaacgaaaagaagtgagatatggaatatgcttattatatttggttaaggatgaaaaacaaacttcaattgctgatga 5174806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University