View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13312_low_11 (Length: 215)
Name: NF13312_low_11
Description: NF13312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13312_low_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 7023894 - 7023677
Alignment:
| Q |
1 |
tgaaatggttgttgtacctttgtggtgtgagtagatgaaacatagaaaatgaacataaatgatataaaactatagtctagattataatgtagatttttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7023894 |
tgaaatggttgttgtacctttgtggtgtgagtagatgaaacatagaaaatgaacataaatgatataaaactatagtctagattataatgtagatttttat |
7023795 |
T |
 |
| Q |
101 |
taacag---nnnnnnnnnttatagaccaaattagatatacaaaactataaattctcgtttaattttcctaattaaatttagtgaaaaaatagattcatat |
197 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7023794 |
taacagaaaaaaaaaaatttatagaccaaattagatatacaaaactataaattctcgtttaattttcctaattaaatttagtgaaaaaatagattcatat |
7023695 |
T |
 |
| Q |
198 |
ttcatattatctctcttt |
215 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7023694 |
ttcatattatctctcttt |
7023677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University