View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13313_high_5 (Length: 293)
Name: NF13313_high_5
Description: NF13313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13313_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 11 - 270
Target Start/End: Original strand, 4498620 - 4498879
Alignment:
| Q |
11 |
gatgaacaattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttgga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4498620 |
gatgaacaattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacatcagatttctacataggaatgggagttgga |
4498719 |
T |
|
| Q |
111 |
tttgcagcagggttttggggggtttgcattgctattttctttatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4498720 |
tttgcagcagggttttggggggtttgcattgctactttcttgatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgttt |
4498819 |
T |
|
| Q |
211 |
atgatacctttgtctttatctgtcaagagggacgaaaatgtgggaattggaccatcccgc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
4498820 |
atgatacctttgtctttatctgtcaagagggatgaaaatgtgggaattggaccataccgc |
4498879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 11 - 226
Target Start/End: Complemental strand, 4329289 - 4329074
Alignment:
| Q |
11 |
gatgaacaattgtaccaaacttaaacaagttttggagggtggaaattccgatgcaggtttcttcaacacattagatttctacataggaatgggagttgga |
110 |
Q |
| |
|
|||||| |||||||| ||| | ||||||||||||||| |||||||||| ||||| |||||| | |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
4329289 |
gatgaataattgtacaaaaatgaaacaagttttggagcgtggaaattctgatgctggtttcgttgacacatcagatttctacgtaggaatgggagttgga |
4329190 |
T |
|
| Q |
111 |
tttgcagcagggttttggggggtttgcattgctattttctttatcagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329189 |
tttgcagcagggttttggggggtttgcattgctattttctttaacagaacttgcaggcatgcttattttcattttcttgaccgcttgaaagatcttgttt |
4329090 |
T |
|
| Q |
211 |
atgatacctttgtctt |
226 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
4329089 |
atgagacctttgtctt |
4329074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 230 - 270
Target Start/End: Complemental strand, 4329036 - 4328996
Alignment:
| Q |
230 |
ctgtcaagagggacgaaaatgtgggaattggaccatcccgc |
270 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||| |||| |
|
|
| T |
4329036 |
ctgtcaagagggatgaaaatgtggaaattggaccataccgc |
4328996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University