View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13314_high_31 (Length: 297)
Name: NF13314_high_31
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13314_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 17 - 272
Target Start/End: Original strand, 42324569 - 42324822
Alignment:
| Q |
17 |
agcaataacagaaattccaagttattgcttcattctcatggaggggacctagcactattttgtttactatatgaaacacacggccaccagactcaagtct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42324569 |
agcaataacagaaattccaagttattgcttcattctcatggaggggacctagcactattttgtttactatatgaaacac--ggccaccagactcaagtct |
42324666 |
T |
|
| Q |
117 |
agtgacacatacgcaacataataattcaaaaaattgaatgcaactacatacatcaatgatgcgtgatggaagccaaaacacgactttgaagtgtagatac |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42324667 |
agtgacacatacacaacataataattcaaaaaattgaatgcaactacatatatcaatgatacgtgatggaggccaaaacacgactttgaagtgtagatac |
42324766 |
T |
|
| Q |
217 |
tatgatctagatgcttttatgacaattgtgttttgtgttttggcttgacatcattg |
272 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42324767 |
tatgatctaaatgcttttatgacaattgtgttttgtgtttcggcttgacatcattg |
42324822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University