View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13314_high_33 (Length: 275)
Name: NF13314_high_33
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13314_high_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 36093849 - 36093620
Alignment:
| Q |
1 |
gacaacactctgagtatttcttgaatagaatataatttgaagttagacaattcctttgtgaggatattaacactgtttctttgcccatatttttggacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36093849 |
gacaacactctgagtatttcttgaatagaatataatttgaagttagacaattcctttgtgaggatattaacactgtttctttgcccatatttttggacaa |
36093750 |
T |
|
| Q |
101 |
aaacacagtttttacccgtctgaaagtatacttccgggcgcgcgtgtgatttttaagaaatttaggtggtggggaagaagctcttattaactatttgttc |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36093749 |
aaacacagtttttacctgtctgaaagtatacttccgggcatgcgtgtgatttttaagaaatttaggtggtggggaagaagctcttattaactatttgttc |
36093650 |
T |
|
| Q |
201 |
aatggtggaacatgagtgacagtgtaacac |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36093649 |
aatggtggaacatgagtgacagtgtaacac |
36093620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 256
Target Start/End: Complemental strand, 36093531 - 36093503
Alignment:
| Q |
228 |
cacaaaatgatcagcggtgcagtgaaagg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36093531 |
cacaaaatgatcagcggtgcagtgaaagg |
36093503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University