View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13314_high_37 (Length: 263)
Name: NF13314_high_37
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13314_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 49 - 252
Target Start/End: Complemental strand, 52809844 - 52809641
Alignment:
| Q |
49 |
aatctaccttaaactctttacagatcgtattataatcttggaatcagcgccatattcaaagatgaattagctctataactttgttttttggataggtaat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52809844 |
aatctaccttaaactctttacagatcgtattataatcttggaatcagcgccatattcaaagatgaattagctctataactttattttttggataggtaac |
52809745 |
T |
 |
| Q |
149 |
tataatgactcattttccttatgatcataaacatcatgtttcgaatctagcattgagtcaaaataatgtgatgacgtgaggacccatatgcttccttcct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52809744 |
tataatgactcattttccttatgatcataaacatcatgtttcgaatctagcattgagtcaaaataatgtgactacgtgaggacccatatgcttccttcct |
52809645 |
T |
 |
| Q |
249 |
tcat |
252 |
Q |
| |
|
|||| |
|
|
| T |
52809644 |
tcat |
52809641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University