View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13314_high_38 (Length: 255)
Name: NF13314_high_38
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13314_high_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 45 - 192
Target Start/End: Complemental strand, 42479308 - 42479155
Alignment:
| Q |
45 |
gaattagaatttgtattcattattctagttagcttttttgtccttctctcttt-ccgac-ggttattcagtaa---atagacactagacataaatgcaga |
139 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42479308 |
gaattggaatttgtattcattattctagttagcttttttgtccttctctctttcccgacgggttattcagtaagctatagacactagacataaatgcaga |
42479209 |
T |
|
| Q |
140 |
aatttaaaattcatatatcttt-taaaatagtacaaagtaacaagaaaccccgt |
192 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42479208 |
aatttaaaattcatatgtctttgtaaaatagtacaaagtaacaagaaaccccgt |
42479155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University