View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13314_high_46 (Length: 236)
Name: NF13314_high_46
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13314_high_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 44 - 230
Target Start/End: Original strand, 36647043 - 36647229
Alignment:
| Q |
44 |
tgcacacgatgttgacacgtagatactattaataatttcataaaatgtaattatatatcttgtatcgcgttagacatcgctatctttaatttaaaatgtt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||| ||| ||||||||||||| |
|
|
| T |
36647043 |
tgcacacgatgttgacacgtagatactattaataatttcataaaatgtaattatatatcttgtaccgcgttacatatcgctaccttcaatttaaaatgtt |
36647142 |
T |
|
| Q |
144 |
ggctgacatggttagcaatataatctctaatatacactttcgaatagattcattaaaagtaaattagttgtgatttgttgatgatgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||| |||| |
|
|
| T |
36647143 |
ggctgacatggttagcaatataatctctaatatacactttcgaatagactcattaaaaatagattagttgtgatttgttgataatgt |
36647229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 36646979 - 36647020
Alignment:
| Q |
1 |
atttgtactattaaactatgaggaatgatattgctagcaaaa |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36646979 |
atttgtactattaaactatgaggaatgatattgctagcaaaa |
36647020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University