View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13314_low_13 (Length: 464)
Name: NF13314_low_13
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13314_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-162; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 149 - 450
Target Start/End: Original strand, 35334985 - 35335286
Alignment:
| Q |
149 |
tgatatgaaagaacaaagcaaacatgaaagttaagagacaaaccaattatagatgtagcacccaaaagggtgtcacctccggcatgcttgcaagatttga |
248 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35334985 |
tgatatgaaagaacaaagcaatcatgaaagttaagagacaaaccaattatagatgtagcacccaaaagggtgtcacctccagcatgcttgcaagatttga |
35335084 |
T |
 |
| Q |
249 |
cataaacaacaccttgaacagctattaagcttctaggatggaaaattgaacgcagtggtgtgtgagcaggggcaagagcaggagtgtgatgatggtgggg |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35335085 |
cataaacaacaccttgaacagctattaagcttctaggatggaaaattgaacgcagtggtgtgtgagcaggggcaagagcaggagtgtgatgatggcgggg |
35335184 |
T |
 |
| Q |
349 |
gtgagggttgggagttggagatttagtaggtacatgggcgtggaatggagggtgaattggaatgtgtttgtgagcaggggcgtgagcaggagggtggtga |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35335185 |
gtgagggttgggagttggagatttagtaggtacatgggcgtggaatggagggtgaattggaatgtgtttgtgagcaggggcgtgagcaggagggtggtga |
35335284 |
T |
 |
| Q |
449 |
tg |
450 |
Q |
| |
|
|| |
|
|
| T |
35335285 |
tg |
35335286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 184 - 274
Target Start/End: Complemental strand, 16592257 - 16592167
Alignment:
| Q |
184 |
agacaaaccaattatagatgtagcacccaaaagggtgtcacctccggcatgcttgcaagatttgacataaacaacaccttgaacagctatt |
274 |
Q |
| |
|
|||||||||| | | |||||||||| | ||||||||||| |||| ||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
16592257 |
agacaaaccattaagagatgtagcattcgaaagggtgtcaactccagcatgcttgcatgatttgacataaacaacaccttcaacagctatt |
16592167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 230 - 285
Target Start/End: Original strand, 35327002 - 35327057
Alignment:
| Q |
230 |
gcatgcttgcaagatttgacataaacaacaccttgaacagctattaagcttctagg |
285 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35327002 |
gcatacttgcaagatttgacataaacaacaccttgaacagctataaagcttctagg |
35327057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 199 - 274
Target Start/End: Complemental strand, 16602746 - 16602671
Alignment:
| Q |
199 |
agatgtagcacccaaaagggtgtcacctccggcatgcttgcaagatttgacataaacaacaccttgaacagctatt |
274 |
Q |
| |
|
|||||||||| | ||||||| ||| |||| ||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
16602746 |
agatgtagcattcgaaagggtttcaactccagcatgcttgcatgatttgacataaacaacaccttcaacagctatt |
16602671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 235 - 268
Target Start/End: Complemental strand, 5342519 - 5342486
Alignment:
| Q |
235 |
cttgcaagatttgacataaacaacaccttgaaca |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5342519 |
cttgcaagatttgacataaacaacaccttgaaca |
5342486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 13 - 49
Target Start/End: Original strand, 35334849 - 35334885
Alignment:
| Q |
13 |
aaaatatgtccattatcgataatcatgcaactttatt |
49 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35334849 |
aaaatatgtccattctcggtaatcatgcaactttatt |
35334885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 217 - 282
Target Start/End: Original strand, 3175390 - 3175455
Alignment:
| Q |
217 |
ggtgtcacctccggcatgcttgcaagatttgacataaacaacaccttgaacagctattaagcttct |
282 |
Q |
| |
|
||||||| | |||| ||| ||||| |||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
3175390 |
ggtgtcaacaccggtatggttgcatgatttgacataaacaacaccttcaacagctatcaagcttct |
3175455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 236 - 282
Target Start/End: Complemental strand, 20964511 - 20964465
Alignment:
| Q |
236 |
ttgcaagatttgacataaacaacaccttgaacagctattaagcttct |
282 |
Q |
| |
|
||||||||||||||||||||||| |||| |||| |||| |||||||| |
|
|
| T |
20964511 |
ttgcaagatttgacataaacaactccttcaacaactatcaagcttct |
20964465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 236 - 268
Target Start/End: Original strand, 38542112 - 38542144
Alignment:
| Q |
236 |
ttgcaagatttgacataaacaacaccttgaaca |
268 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
38542112 |
ttgcaagatttgacataaacaacacctcgaaca |
38542144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University