View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13314_low_15 (Length: 438)
Name: NF13314_low_15
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13314_low_15 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 166 - 326
Target Start/End: Original strand, 21227843 - 21228003
Alignment:
| Q |
166 |
ctttacttctcttacaaacccctctttctttgctcatcacctaaaaagacacgcttttttagtcatttgcgtgtttgccactacggagtgtatgtttttg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21227843 |
ctttacttctcttacaaacccctctttctttgctcatcacctaaaaagacacgcttttttagtcatttgcgtgtttgccactacggagtgtatgtttttg |
21227942 |
T |
 |
| Q |
266 |
tcttaagcaacgtgtaaaatgaatcaatcaactcaaaataatagttcggaatttcaataat |
326 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
21227943 |
tcttaagcaccgtgtaaaatgaatcaatcaactcaaaaaaatagtttggaatttcaataat |
21228003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 19 - 139
Target Start/End: Original strand, 21227689 - 21227808
Alignment:
| Q |
19 |
atccactcatgaagaatcgtcggaaatttcaattcaattcagtgttatgtgtgaaagnnnnnnnngagtagagaatgtaatgtaatgatataaggcttct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21227689 |
atccactcatgaagaatcgtcggaaatttcaattcaattcagtgttatgtgtgaaag-aaaaaaagagtagagaatgtaatgtaatgatataaggcttct |
21227787 |
T |
 |
| Q |
119 |
tcgcgcgcctgcgaccacacc |
139 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21227788 |
tcgcgcgcctgcgaccacacc |
21227808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 328 - 438
Target Start/End: Original strand, 31402911 - 31403021
Alignment:
| Q |
328 |
gcttaaatacgaaaattatccccgtaaatatatgatattttagttttagtctttgtaaaaatannnnnnnnngttttagtctctgcaaatattaaaattt |
427 |
Q |
| |
|
||||||||| |||||| |||| | |||||| ||||||||| ||||||||| ||||||||||| ||||||||| |||||||||| ||| || |
|
|
| T |
31402911 |
gcttaaatatgaaaatagtccctgcaaatatctgatattttggttttagtccttgtaaaaatattttttggggttttagtccctgcaaatataaaatatt |
31403010 |
T |
 |
| Q |
428 |
tggttttggtc |
438 |
Q |
| |
|
||||||||||| |
|
|
| T |
31403011 |
tggttttggtc |
31403021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 327 - 390
Target Start/End: Complemental strand, 6892133 - 6892070
Alignment:
| Q |
327 |
agcttaaatacgaaaattatccccgtaaatatatgatattttagttttagtctttgtaaaaata |
390 |
Q |
| |
|
|||||||||| |||||| |||| |||||||| ||| ||||||||||||||| |||||||||| |
|
|
| T |
6892133 |
agcttaaatatgaaaataatccttgtaaatatctgacattttagttttagtccctgtaaaaata |
6892070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 400 - 438
Target Start/End: Original strand, 26479395 - 26479433
Alignment:
| Q |
400 |
gttttagtctctgcaaatattaaaattttggttttggtc |
438 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
26479395 |
gttttagtcactgcaaatataaaaattttggttttggtc |
26479433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 327 - 390
Target Start/End: Original strand, 43191654 - 43191717
Alignment:
| Q |
327 |
agcttaaatacgaaaattatccccgtaaatatatgatattttagttttagtctttgtaaaaata |
390 |
Q |
| |
|
|||||||||| ||||||| |||| | |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
43191654 |
agcttaaatatgaaaattgtccctgcaaatatctgatattttagttttagtccctgtaaaaata |
43191717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 400 - 438
Target Start/End: Complemental strand, 28031960 - 28031922
Alignment:
| Q |
400 |
gttttagtctctgcaaatattaaaattttggttttggtc |
438 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
28031960 |
gttttagtccctgcaaatataaaaattttggttttggtc |
28031922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 328 - 438
Target Start/End: Original strand, 30608865 - 30608974
Alignment:
| Q |
328 |
gcttaaatacgaaaattatccccgtaaatatatgatattttagttttagtctttgtaaaaatannnnnnnnngttttagtctctgcaaatattaaaattt |
427 |
Q |
| |
|
||||||||| |||||| |||| | |||||| ||||||||||||||||||| |||||||||| ||||||||| |||||||||| |||| || |
|
|
| T |
30608865 |
gcttaaatatgaaaatagtccctgcaaatatttgatattttagttttagtccctgtaaaaata-tttttttggttttagtccctgcaaatataaaaaatt |
30608963 |
T |
 |
| Q |
428 |
tggttttggtc |
438 |
Q |
| |
|
||||||||||| |
|
|
| T |
30608964 |
tggttttggtc |
30608974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 400 - 438
Target Start/End: Complemental strand, 19158006 - 19157968
Alignment:
| Q |
400 |
gttttagtctctgcaaatattaaaattttggttttggtc |
438 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
19158006 |
gttttagtccctgcaaatataaaaattttggttttggtc |
19157968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 400 - 438
Target Start/End: Complemental strand, 20757405 - 20757367
Alignment:
| Q |
400 |
gttttagtctctgcaaatattaaaattttggttttggtc |
438 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
20757405 |
gttttagtccctgcaaatataaaaattttggttttggtc |
20757367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 400 - 438
Target Start/End: Complemental strand, 44483539 - 44483501
Alignment:
| Q |
400 |
gttttagtctctgcaaatattaaaattttggttttggtc |
438 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
44483539 |
gttttagtccctgcaaatataaaaattttggttttggtc |
44483501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 400 - 438
Target Start/End: Original strand, 32592813 - 32592851
Alignment:
| Q |
400 |
gttttagtctctgcaaatattaaaattttggttttggtc |
438 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
32592813 |
gttttagtccctgcaaatataaaaattttggttttggtc |
32592851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 330 - 390
Target Start/End: Complemental strand, 42239455 - 42239395
Alignment:
| Q |
330 |
ttaaatacgaaaattatccccgtaaatatatgatattttagttttagtctttgtaaaaata |
390 |
Q |
| |
|
||||||| |||||| |||| | |||||| ||| |||||||||||||||| |||||||||| |
|
|
| T |
42239455 |
ttaaatatgaaaatagtccctgcaaatatctgacattttagttttagtctctgtaaaaata |
42239395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 400 - 438
Target Start/End: Original strand, 29838364 - 29838402
Alignment:
| Q |
400 |
gttttagtctctgcaaatattaaaattttggttttggtc |
438 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
29838364 |
gttttagtctctgcaaatataaaaaatttggttttggtc |
29838402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University