View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13314_low_35 (Length: 318)
Name: NF13314_low_35
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13314_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 30109102 - 30108822
Alignment:
| Q |
1 |
tgccttcacgagtaaatctttcactttagtaccataatagaaccattttgttgacaaatttaaagtccaacacatttcaaacatgaaaatgtttatccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30109102 |
tgccttcacgagtaaatctttcactttagtaccatattagaaccattttgttgacaaatttaaagtccaacacatttcaaacatgaaaatgtttatccca |
30109003 |
T |
 |
| Q |
101 |
caaaatgcatcacatggaaggctcaacaatgagata--------attacttgaattactattaaagaaatgtttgtctcaactcaagcaatgaaatgcca |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30109002 |
caaaatgcatcacatggaaggctcaacaatgagataattatccaattacttcaattactattaaagaaatgtttgt-----ctcaagcaatgaaatgcca |
30108908 |
T |
 |
| Q |
193 |
accaaaattgtgtatttgttattttgtttcaaattcccttactatgccttatccgaaatcaaatcccttattttatattgtccattttagcttcac |
288 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30108907 |
accaaaattgtgtatttgttattttctttcgaattc----------ccttatccgaaatcaaatctcttattttatattgtccattttagcttcac |
30108822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University