View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13314_low_45 (Length: 255)

Name: NF13314_low_45
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13314_low_45
NF13314_low_45
[»] chr3 (1 HSPs)
chr3 (45-192)||(42479155-42479308)


Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 45 - 192
Target Start/End: Complemental strand, 42479308 - 42479155
Alignment:
45 gaattagaatttgtattcattattctagttagcttttttgtccttctctcttt-ccgac-ggttattcagtaa---atagacactagacataaatgcaga 139  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||   ||||||||||||||||||||||||    
42479308 gaattggaatttgtattcattattctagttagcttttttgtccttctctctttcccgacgggttattcagtaagctatagacactagacataaatgcaga 42479209  T
140 aatttaaaattcatatatcttt-taaaatagtacaaagtaacaagaaaccccgt 192  Q
    |||||||||||||||| ||||| |||||||||||||||||||||||||||||||    
42479208 aatttaaaattcatatgtctttgtaaaatagtacaaagtaacaagaaaccccgt 42479155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University