View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13314_low_49 (Length: 240)
Name: NF13314_low_49
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13314_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 71 - 221
Target Start/End: Complemental strand, 42165753 - 42165603
Alignment:
| Q |
71 |
cctagggtagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaac |
170 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42165753 |
cctagggcagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaac |
42165654 |
T |
|
| Q |
171 |
ttcttactcattgtcttaatattggcatatctgctctccagtccaatggtt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
42165653 |
ttcttactcattgtcttaatattggcatatttgctctccgttccaatggtt |
42165603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 86 - 207
Target Start/End: Complemental strand, 5481266 - 5481145
Alignment:
| Q |
86 |
atggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttactcattgtc |
185 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||| || ||||| || ||||||||||| | |||||||| ||||||||||||||||||||||||| | || |
|
|
| T |
5481266 |
atgggtggttgggcaattgctgtgcatggtggtgctggtgttgaccctaatctccctcttcaacgtcaagaagaagccaaacaacttcttactcgtgttc |
5481167 |
T |
|
| Q |
186 |
ttaatattggcatatctgctct |
207 |
Q |
| |
|
| ||| ||||||| |||||||| |
|
|
| T |
5481166 |
tcaatcttggcatctctgctct |
5481145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 42165819 - 42165776
Alignment:
| Q |
1 |
agcaccaagttttcagtggtctcatcacacactcactctcttac |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42165819 |
agcaccaagttttcagtggtctcatcacacactcactctcttac |
42165776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 91 - 218
Target Start/End: Original strand, 47170183 - 47170310
Alignment:
| Q |
91 |
tggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttactcattgtcttaat |
190 |
Q |
| |
|
|||||||||||||||||| ||||| || || |||||||||||||| ||||||||||| |||||| ||||||||||||| |||||||| | ||||| ||| |
|
|
| T |
47170183 |
tggttgggctattgctgttcatggcggtgcaggtgtggatcctaacctcccaccacaccgtcagcaagaagccaaacagcttcttaccgaatgtctcaat |
47170282 |
T |
|
| Q |
191 |
attggcatatctgctctccagtccaatg |
218 |
Q |
| |
|
| || || |||||||||| ||||||| |
|
|
| T |
47170283 |
ctcggtatctctgctctccgatccaatg |
47170310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University