View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13314_low_49 (Length: 240)

Name: NF13314_low_49
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13314_low_49
NF13314_low_49
[»] chr1 (3 HSPs)
chr1 (71-221)||(42165603-42165753)
chr1 (86-207)||(5481145-5481266)
chr1 (1-44)||(42165776-42165819)
[»] chr3 (1 HSPs)
chr3 (91-218)||(47170183-47170310)


Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 71 - 221
Target Start/End: Complemental strand, 42165753 - 42165603
Alignment:
71 cctagggtagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaac 170  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42165753 cctagggcagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaac 42165654  T
171 ttcttactcattgtcttaatattggcatatctgctctccagtccaatggtt 221  Q
    |||||||||||||||||||||||||||||| ||||||||  ||||||||||    
42165653 ttcttactcattgtcttaatattggcatatttgctctccgttccaatggtt 42165603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 86 - 207
Target Start/End: Complemental strand, 5481266 - 5481145
Alignment:
86 atggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttactcattgtc 185  Q
    |||| ||||||||| ||||||||||||||||| || ||||| || ||||||||||| |  |||||||| ||||||||||||||||||||||||| |  ||    
5481266 atgggtggttgggcaattgctgtgcatggtggtgctggtgttgaccctaatctccctcttcaacgtcaagaagaagccaaacaacttcttactcgtgttc 5481167  T
186 ttaatattggcatatctgctct 207  Q
    | ||| ||||||| ||||||||    
5481166 tcaatcttggcatctctgctct 5481145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 42165819 - 42165776
Alignment:
1 agcaccaagttttcagtggtctcatcacacactcactctcttac 44  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
42165819 agcaccaagttttcagtggtctcatcacacactcactctcttac 42165776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 91 - 218
Target Start/End: Original strand, 47170183 - 47170310
Alignment:
91 tggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttactcattgtcttaat 190  Q
    |||||||||||||||||| ||||| || || |||||||||||||| ||||||||||| |||||| ||||||||||||| ||||||||  | ||||| |||    
47170183 tggttgggctattgctgttcatggcggtgcaggtgtggatcctaacctcccaccacaccgtcagcaagaagccaaacagcttcttaccgaatgtctcaat 47170282  T
191 attggcatatctgctctccagtccaatg 218  Q
     | || || ||||||||||  |||||||    
47170283 ctcggtatctctgctctccgatccaatg 47170310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University