View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13314_low_55 (Length: 226)

Name: NF13314_low_55
Description: NF13314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13314_low_55
NF13314_low_55
[»] chr8 (1 HSPs)
chr8 (1-216)||(29606641-29606856)


Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 29606856 - 29606641
Alignment:
1 ctggtgcttctttggccggtgctggtgcttttggaacctttgcaggtgctggggatacctttggtggtttagaagctggtggtaatggtaatggtggaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29606856 ctggtgcttctttggccggtgctggtgcttttggaacctttgcaggtgctggggatacctttggtggtttagaagctggtggtaatggtaatggtggaag 29606757  T
101 tgaaacaggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttaggggatggggtttttgggcttaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29606756 tgaaacaggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttaggggatggggtttttgggcttaat 29606657  T
201 gccggtgtaacctttg 216  Q
    ||||||||||||||||    
29606656 gccggtgtaacctttg 29606641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University