View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13315_high_9 (Length: 236)
Name: NF13315_high_9
Description: NF13315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13315_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 55 - 221
Target Start/End: Complemental strand, 39680252 - 39680086
Alignment:
| Q |
55 |
gtggaccctctacagcatcaccaccaacatcaaaaacaaacttccttttctcgcttctgttattactactactgctactactaccgccagagctttcacc |
154 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39680252 |
gtggaccctctacatcatcaccaccaacatcaaaaacaaactttcttttctcgcttctgttattactactactgctactactaccgccagagctttcacc |
39680153 |
T |
 |
| Q |
155 |
ttcctctgaaatagtcaatttatggcatttatcagtaactccaagcaaagcttcttcttgattcata |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39680152 |
ttcctctgaaatagtcaatttatggcatttatcagtaactccaagcaaagcttcttcttgattcata |
39680086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 39680070 - 39680030
Alignment:
| Q |
9 |
gcactatctcttgctgtcatcttatcttgcaaagtttttga |
49 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39680070 |
gcactatctcttgcggtcatcttatcttgcaaagtttttga |
39680030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University