View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13315_low_13 (Length: 309)
Name: NF13315_low_13
Description: NF13315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13315_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 159 - 292
Target Start/End: Original strand, 17801586 - 17801719
Alignment:
| Q |
159 |
actatggtcctaaagatgatgcattagaattttaagtataactgatttgtataggaagatagttgaggtgaagctctaattctgtttttgatgtgctatt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17801586 |
actatggtcctaaagatgatgcattagaattttaagtataactgatttgtataggaagatagttgaggtgaagctctaattctgtttttgatgtgctatt |
17801685 |
T |
|
| Q |
259 |
agagcttctaccagatttattgagagtgtgaact |
292 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
17801686 |
agagcttctacaagatttattgagagtgtgaact |
17801719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 17801428 - 17801518
Alignment:
| Q |
1 |
accctccacgacactttgtaaaaaggccgattgataaattgggctctaattatgggtttttggttcaattattagagcctgctgaacagaa |
91 |
Q |
| |
|
||||| ||| ||||||||||||||| || ||||| |||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17801428 |
accctacactacactttgtaaaaagacctattgagaaattgggctctaattatggttttttggttaaattattagagcctgctgaacagaa |
17801518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University