View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13316_high_20 (Length: 213)
Name: NF13316_high_20
Description: NF13316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13316_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 1216425 - 1216250
Alignment:
| Q |
18 |
atgaatgcatacgtacataagtacatgtttatataagcatatgcttctttaagaacgcataacatattagtatttttgtactaccttaaatgaaatatta |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
1216425 |
atgaatgcatacgtacgtaagtacatgtttatataagcatatgcttctttaagaacgcataacatattagtatttttgtactaccttaaacgaaatgtta |
1216326 |
T |
 |
| Q |
118 |
gaaggcgaggtttcttgttgaacactccctcctcaaattgtactttgcgttttaaatcttttggatctacttccat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1216325 |
gaaggcgaggtttcttgttgaacactccctcctcaaattgtactctgcgttttaaatcttttggatctacttccat |
1216250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University