View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13316_high_21 (Length: 211)
Name: NF13316_high_21
Description: NF13316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13316_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 52887246 - 52887433
Alignment:
| Q |
1 |
atatcactggacatgtggaatctttggccattgatgatggaaacactatcagattgggctatttatttctttccaagtatggctctcaaatacatctgac |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||| ||||| ||| |
|
|
| T |
52887246 |
atatcactggacatgtggaacctttggccattgatgatggaagcactatcagattgggctattgatttcttttcaagtatggctctcaactacatttgat |
52887345 |
T |
 |
| Q |
101 |
tacaattcatctcaacttatcttcttcgccttacaaaagttcattacttttcaacttc-tttttatatgttaataacatagaaagctagagat |
192 |
Q |
| |
|
| ||||| ||||||||||| |||| ||||| |||||||||| ||| ||| ||||| |||||| |||||||||| |||| |||||||||| |
|
|
| T |
52887346 |
tgcaatt-atctcaactta---tctttgccttccaaaagttcagtac-tttggacttcttttttacttgttaataacttagacagctagagat |
52887433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 106 - 192
Target Start/End: Complemental strand, 43716544 - 43716457
Alignment:
| Q |
106 |
ttcatctcaacttatcttcttcgccttacaaaagttcattacttttcaacttctttttatatgttaataacatag-aaagctagagat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43716544 |
ttcatctcaacttatcttcttcgccttacaaaagttcattacttttcaacttctttttatatgttaataacatagaaaagctagagat |
43716457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 43716610 - 43716542
Alignment:
| Q |
1 |
atatcactggacatgtggaatctttggccattgatgatggaaacactatcagattgggctatttatttc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43716610 |
atatcactggacatgtggaatctttggccattgatgatggaaacactatcagattgggctattgatttc |
43716542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 6814766 - 6814847
Alignment:
| Q |
1 |
atatcactggacatgtggaatctttggccattgatgatggaaacactatcagattgggctatttatttctttccaagtatgg |
82 |
Q |
| |
|
||||| ||||| ||||||| |||||||||| ||||||||||| || | |||||||||| || |||| ||||||||||||| |
|
|
| T |
6814766 |
atatctctggatatgtggagtctttggccagtgatgatggaagcattggcagattgggcaatcgatttttttccaagtatgg |
6814847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University