View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13316_high_7 (Length: 406)
Name: NF13316_high_7
Description: NF13316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13316_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 9 - 389
Target Start/End: Original strand, 7453100 - 7453480
Alignment:
| Q |
9 |
acatcatcaaactattacattacatgtatcatttcactctttgttctctttgttttcctttgtttcaagatatataccattaaggggtgtacacaaaaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7453100 |
acatcatcaaactattacattacatgtatcatatcactctttgttctctttgttttcctttgtttcaagatatataccattaaggggtgtacacaaaaca |
7453199 |
T |
 |
| Q |
109 |
ttttccataattgatatcactcacatgtatcaatatccaattattgctattcatgcaatctatgcaaacactaatgtatccatgcgtaagatggaatgca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7453200 |
ttttccataattgatatcactcacatgtatcaatatccaattattgctattcatgcaatctatgcaaacactaatgtatccatgcgtaagatggaatgca |
7453299 |
T |
 |
| Q |
209 |
aacctatcattgaggtttgagaggttcctatttttgcttgcaaaggcaaaattaattaatgatcatatcctaaaaatttacgagagcacgtttggtgttt |
308 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7453300 |
aacctatcattgaggcttgagaggttcctatttttgcttgcaaaggcaaaattaattaatgatcatatcctaaaaatttacgagagcacgtttggtgttt |
7453399 |
T |
 |
| Q |
309 |
gaaggatagaaccaggttccataatttgtgatgttaaggtggtggagagtaaatgttttctcataaaaattgttacacatg |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7453400 |
gaaggatagaaccaggttccataatttgtgatgttaagggggtggagagtaaatgtttgctcataaaaattgttacacatg |
7453480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University