View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13316_low_13 (Length: 319)
Name: NF13316_low_13
Description: NF13316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13316_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 221
Target Start/End: Complemental strand, 42597971 - 42597760
Alignment:
| Q |
10 |
tatgaagttactagtggtagcgttgttttcaaaggggaaaatttgcttgaaatggaacctgaagaaagagcccttgaaggtcttttcatgagttttcaat |
109 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42597971 |
tatgaagttaccagtggtagcgttgttttcaaaggggaaaatttgcttgaaatggaacctgaagaaagagcccttgaaggtcttttcatgagttttcaat |
42597872 |
T |
|
| Q |
110 |
cacctgttgcaattcctggcgtttccaatgatcaatttcttgttatggcttataatgctcggagaaagaaacttggtcttcctgaacttggaccccttga |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42597871 |
cacctgtagcaattcctggcgtttccaatgatcaatttcttgttatggcttataatgctcggagaaagaaacttggtcttcctgaacttggaccccttga |
42597772 |
T |
|
| Q |
210 |
ggttcattatcc |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42597771 |
ggttcattatcc |
42597760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 42597723 - 42597678
Alignment:
| Q |
258 |
gttgataattgcggtgaaatgctgtttatacaaacttatttgtaat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42597723 |
gttgataattgcggtgaaatgctgtttatacaaacttatttgtaat |
42597678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University