View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13317_high_3 (Length: 239)

Name: NF13317_high_3
Description: NF13317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13317_high_3
NF13317_high_3
[»] chr3 (1 HSPs)
chr3 (84-122)||(19136874-19136912)


Alignment Details
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 84 - 122
Target Start/End: Original strand, 19136874 - 19136912
Alignment:
84 ctaactcaaataattcttgtaccaagctagatattacaa 122  Q
    |||||||||||||||||||||||||||||||||||||||    
19136874 ctaactcaaataattcttgtaccaagctagatattacaa 19136912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University