View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13317_high_4 (Length: 228)
Name: NF13317_high_4
Description: NF13317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13317_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 41 - 219
Target Start/End: Complemental strand, 19136760 - 19136581
Alignment:
| Q |
41 |
taatatttccagttgggttaactctgcttttgatactttaaaaattttaatatgattttaacaaaaaa-tgaaaattaatatgataagtcatagtcatag |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19136760 |
taatatttccagttgggttaactctgcttttgatactttaaaaaaattaatatgattttaccaaaaaaatgaaaattaatatgataagtcatagtcatag |
19136661 |
T |
 |
| Q |
140 |
tttcctccttgttagattttatttcttttggacttatgtacctgaatgtttttccagcatgagactttgtttgatgatgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19136660 |
tttcctccttgttagattttatttcttttggacttatgtacctgaatgtttttccagcatgagactttgtttgctgatgt |
19136581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University