View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13317_low_3 (Length: 264)
Name: NF13317_low_3
Description: NF13317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13317_low_3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 62 - 264
Target Start/End: Original strand, 38008178 - 38008380
Alignment:
| Q |
62 |
gaccccttcattaccaccaattgtttgcggtgacaacttgtgtacactgtacagtcaattatctctgaacccaattctggcagctgcaaaaacattttct |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38008178 |
gaccccttcattaccaccaattgtttgcggtgacaacttgtgtacactgtacagtcaattatctctgaacccaattctggcagctgcaaaaacattttct |
38008277 |
T |
 |
| Q |
162 |
ttgtcggagaaaatgttccgaccatgacacgcgggtggcctgcaatctatatcttaagatcatgtgactgtgacagatgcactcaactcagacaaactga |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38008278 |
ttgtcggagaaaatgttccgaccatgacacgcgggtggcctgcaatctatatcttaagatcatgtgactgtgacagatgcactcaactcagacaaactga |
38008377 |
T |
 |
| Q |
262 |
gac |
264 |
Q |
| |
|
||| |
|
|
| T |
38008378 |
gac |
38008380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University