View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13317_low_4 (Length: 239)
Name: NF13317_low_4
Description: NF13317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13317_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 84 - 122
Target Start/End: Original strand, 19136874 - 19136912
Alignment:
| Q |
84 |
ctaactcaaataattcttgtaccaagctagatattacaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19136874 |
ctaactcaaataattcttgtaccaagctagatattacaa |
19136912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University