View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13318_high_3 (Length: 268)
Name: NF13318_high_3
Description: NF13318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13318_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 259
Target Start/End: Complemental strand, 40812854 - 40812612
Alignment:
| Q |
17 |
ataatgaccgtacaaaatgtgtcaaatggcggctagagctgcaaaacagcacactacgaagcagaatttgaaaaaactgctatcttccggtttgtaaacc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
40812854 |
ataatgaccgtacaaaatgtgtcaaatggtggctagagctgcaaaacagcatactacgaagcagaatttgaaaaaactgctatctttcggtttgtagacc |
40812755 |
T |
 |
| Q |
117 |
aacaaaatatatgatgtattgtttgttacttcccacaaaccatatggatttggagttcctgctatgggagttgaatgcgtgcatgcatgaacagttgaac |
216 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40812754 |
accaaaatatatgatgtattgtttgttacttcccacaaaccatatggatttggagttcctgctgtgggagttgaatgcgtgcatgcatgaacagttgaac |
40812655 |
T |
 |
| Q |
217 |
acactgtgcctttgtatgtcatgaatctgttatgtgcctttgt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40812654 |
acactgtgcctttgtatgtcatgaatctgttatgtgcctttgt |
40812612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University