View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13318_low_4 (Length: 307)
Name: NF13318_low_4
Description: NF13318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13318_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 290
Target Start/End: Original strand, 6708347 - 6708611
Alignment:
| Q |
19 |
atcctcctccggccatggatatgccgatcatgcacgacagcgaccgttacgatttcgttcgagatattggatcagggaatttcggcgttgctagactcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6708347 |
atcctcctccggccatggatatgccgatcatgcacgacagcgaccgttacgatttcgttcgagatattggatcagggaatttcggcgttgctagactcat |
6708446 |
T |
|
| Q |
119 |
gagagataaacacaccaaagagcttgttgctgtcaaatatatcgaacgcggagataaggtttcattccatcatcttttattatttgnnnnnnnccgttac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
6708447 |
gagagataaacacaccaaagagcttgttgctgtcaaatatatcgaacgcggagataaggtttccttccatcatcttttattatttg---ttttccgttaa |
6708543 |
T |
|
| Q |
219 |
ttactatctatgctcacgtatcatatatcatactactgcaaagttgatgatgatattagttgataatttcta |
290 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
6708544 |
tta----ctatgctcacgtatcatatatcatactactgctaagttgatgatgttattagttgataatttcta |
6708611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 33 - 179
Target Start/End: Complemental strand, 34130391 - 34130245
Alignment:
| Q |
33 |
atggatatgccgatcatgcacgacagcgaccgttacgatttcgttcgagatattggatcagggaatttcggcgttgctagactcatgagagataaacaca |
132 |
Q |
| |
|
|||||| | ||||||||||||||||| || || |||||| | ||||| ||||| || || || |||||||| ||||||| | ||| ||||||||| | |
|
|
| T |
34130391 |
atggatttaccgatcatgcacgacagtgatcggtacgatctggttcgtgatatcgggtccggaaatttcggtattgctaggttgatgcaagataaacaaa |
34130292 |
T |
|
| Q |
133 |
ccaaagagcttgttgctgtcaaatatatcgaacgcggagataaggtt |
179 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || ||||||||| |
|
|
| T |
34130291 |
ccaaagagcttgttgctgttaaatatatcgaacgtggtgataaggtt |
34130245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 81 - 160
Target Start/End: Original strand, 12308724 - 12308803
Alignment:
| Q |
81 |
gatattggatcagggaatttcggcgttgctagactcatgagagataaacacaccaaagagcttgttgctgtcaaatatat |
160 |
Q |
| |
|
|||||||| || |||||||| || || ||||| || ||||||||||||||||| || | |||||||||||||| ||||| |
|
|
| T |
12308724 |
gatattggttctgggaattttggagtggctaggcttatgagagataaacacactaatcaacttgttgctgtcaagtatat |
12308803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University