View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1331_high_6 (Length: 314)
Name: NF1331_high_6
Description: NF1331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1331_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 41 - 222
Target Start/End: Complemental strand, 8063001 - 8062820
Alignment:
| Q |
41 |
atgaaagaggggtagcaggacttgaagcttgagcttttccggcatcagcagaaggaggaagaacggcggcgccgccataagaagaagggttgttttgaat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8063001 |
atgaaagaggggtagcaggacttgaagcttgagcttttccggcatcagaagaaggaggaagaacggcggcgccgccataagaagaagggttgttttgaat |
8062902 |
T |
 |
| Q |
141 |
tgcagatctctgctttttacacccccatgagtatgttacactactcaacaaagagaaacgatgatataataaagcaagaatt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8062901 |
tgcagatctctgctttttacacccccatgagtatgttacactactcaacaaagagaaacgatgatataataaagcaagaatt |
8062820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University