View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1331_low_10 (Length: 422)
Name: NF1331_low_10
Description: NF1331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1331_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 85 - 332
Target Start/End: Original strand, 25303651 - 25303898
Alignment:
| Q |
85 |
aataatgatagaacacaagattaaatccatcagaccttggggacttatcaggttgcatttgaaatagggcatgtttgcgctcttttctagtaatcagtgt |
184 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25303651 |
aataatgatagaacgcaggattaaatccatcagacctcgaggacttatcaggttgcatttgaaatagggcatgtttgagctcttttctagtaatcagtgt |
25303750 |
T |
|
| Q |
185 |
cataagcatatcattgtattcgtgggtaacccacacactttagaaaatcaagaacatgcgtatggttaccattgttggccgcaaaaaccacatcaaaata |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25303751 |
cataagcatatcattgtattcgtgggtaacccacacactttagaaaatcaagaacatgcgtatggttaccattgttggctgcaaaaaccacatcaaaata |
25303850 |
T |
|
| Q |
285 |
attctttgctacatcacataggtgctcctatctcataaccaaataacc |
332 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25303851 |
attatttgctacatcacataggtgctcctatctcataaccaaataacc |
25303898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 15 - 86
Target Start/End: Original strand, 25302553 - 25302624
Alignment:
| Q |
15 |
tatgtattaatcatccgttttatatcatgaaccatggaattatggaggacatatatactaataatataggaa |
86 |
Q |
| |
|
||||| ||||||||| |||||||||||||| | ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
25302553 |
tatgtgttaatcatctgttttatatcatgaccaatggaattatggaggtcatatatactcataatataggaa |
25302624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University