View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1331_low_19 (Length: 318)
Name: NF1331_low_19
Description: NF1331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1331_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 104 - 241
Target Start/End: Complemental strand, 1887720 - 1887583
Alignment:
| Q |
104 |
agtaacacatcctaaatattatatggctgaattgttgttcatgatctgcagaacatgaacaaacaaacaattcagtcattaatgattgaacaagcacaac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1887720 |
agtaacacatcctaaatattatatggctgaattgttgttcatgatctgcagaacatgaacaaacaaacaattcagtcattaatgattgaacaagcacaac |
1887621 |
T |
|
| Q |
204 |
atgactgatgtatgacaacatacaaatacaacctatga |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1887620 |
atgactgatgtatgacaacatacaaatacaacctatga |
1887583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University