View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1331_low_20 (Length: 316)
Name: NF1331_low_20
Description: NF1331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1331_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 96 - 238
Target Start/End: Original strand, 5968826 - 5968968
Alignment:
| Q |
96 |
ttataacttggtttgcatccacgacctgcaaccaagtccagttatagttttactgatatgttcggtactatttttgtataattgaatttataaatatctg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| | ||||||||||||| || ||||||||||||||| ||| |
|
|
| T |
5968826 |
ttataacttggtttgcatccacgacctgcaaccaagtccagctaatgttttactgatatg-tatgtactatttttgtctagttgaatttataaataactg |
5968924 |
T |
|
| Q |
196 |
aattgtacta-taggaataatttggcataatctatattaatact |
238 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5968925 |
aatggtactattaggaataatttggcataatctatattaatact |
5968968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University