View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1331_low_23 (Length: 307)
Name: NF1331_low_23
Description: NF1331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1331_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 42375945 - 42375729
Alignment:
| Q |
1 |
accaatcttactaataaatttgcttataagctgcataatttgaggaacaatttaccatatagaaacatggtttaaagattaatttagcatgaggacaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42375945 |
accaatcttactaataaatttgctaataagctgcataatttgaggaccaatttaccatatagaaacatggtttaaagattaatttagcatgaggacaaaa |
42375846 |
T |
|
| Q |
101 |
ttggtcaacatcattcaaaagcctctttatcttcatcaactttagggtgactgactcctaaaaatttagagggtgaatccgtaatttactctacacatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42375845 |
ttggtcaacatcattcaaaagcctctttatcttcatcaactttagggt----gactcctaaaagattagagggtgaatccgtaatttactctacacatag |
42375750 |
T |
|
| Q |
201 |
taacaataacaccaaccaaca |
221 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
42375749 |
taacaataacaccaaacaaca |
42375729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University