View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1331_low_26 (Length: 292)
Name: NF1331_low_26
Description: NF1331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1331_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 30 - 232
Target Start/End: Original strand, 6425947 - 6426148
Alignment:
| Q |
30 |
tctgagttgtactgatataagtgaaataatttggaannnnnnnnctaataattgttaataaattatcaattaaagggttgttgatgctggtggaagacat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6425947 |
tctgagttgtactgatataagtgaaataatttggaattttttttctaataattgttaatagattatcaattaaagggttgttgatgctggtggaagacat |
6426046 |
T |
 |
| Q |
130 |
agttagagctcataaggtggggaaactaggaaattaattcctttatgaatataagacaaattacatacaatagtcttatttctaaccattaagttatttg |
229 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6426047 |
agttagagctcataaggtggg-aaactaggaaattaattcctttatgaatataagacaaattacatacaatagtcttatttctaaccattaagttatttg |
6426145 |
T |
 |
| Q |
230 |
att |
232 |
Q |
| |
|
||| |
|
|
| T |
6426146 |
att |
6426148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University