View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1331_low_29 (Length: 288)
Name: NF1331_low_29
Description: NF1331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1331_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 49 - 171
Target Start/End: Complemental strand, 12825960 - 12825839
Alignment:
| Q |
49 |
ataggtggaggtggggtttggaagagtcagggannnnnnncggtcaaatcaacatatgataagctagtggggttagtgttggaggaagatttgtggagta |
148 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12825960 |
ataggtggcggtggggtttggaagagttagggatttttt-cggtcaaatcaacatattataagctagtggggttagtgttggaggaagatttgtggagta |
12825862 |
T |
 |
| Q |
149 |
cggaggagaagagtgtttctgcc |
171 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12825861 |
cggaggagaagagtgtttctgcc |
12825839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 170 - 222
Target Start/End: Complemental strand, 12825817 - 12825765
Alignment:
| Q |
170 |
ccttcgaaggttgtagcgttttcttggaagttcctatatgatcaaatacctac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||| |||| |
|
|
| T |
12825817 |
ccttcgaaggttgtagcgttttcttggaagctcctatatgatcgaatatctac |
12825765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University