View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13320_low_12 (Length: 238)
Name: NF13320_low_12
Description: NF13320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13320_low_12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 330611 - 330831
Alignment:
| Q |
18 |
gaaaggaatgcatggatgcatgcatgagagagggaattatgtaattaacgtacgtaccatccttctaaacaaccagggccgcttgaattgttgtgattgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
330611 |
gaaaggaatgcatggatgcatgcatgagagagggaattatataattaacgaacgtaccatccttctaaacaaccagggccgcttgaattgttgtgattgt |
330710 |
T |
|
| Q |
118 |
gtacatgttgaggaggtggaggttgagcgtattgaggaggagcatattgtggaggatacccttgtgctgggtagggtggtggaggatatccttgttgcgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
330711 |
gtacatgttgaggaggtggaggttgagcgtattgaggaggagcatattgtggaggatacccttgtgctgggtagggtggtggaggatatccttgttgcgg |
330810 |
T |
|
| Q |
218 |
tggataacctggtggtggata |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
330811 |
tggataacctggtggtggata |
330831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University