View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13320_low_13 (Length: 236)
Name: NF13320_low_13
Description: NF13320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13320_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 16512709 - 16512931
Alignment:
| Q |
1 |
agcaaaagagttcattgtctggaactct--tttctggaactatcattctgaaattgggatgctttcaatttcagaatagcttggaagatctattcagtct |
98 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
16512709 |
agcaaaagagttaattgtctggaactctcgtttctggaactatcattctgaaattgggatgctttctattccagaatagcttggaagatctattcagtct |
16512808 |
T |
|
| Q |
99 |
cttgtctttcttgcgtgtacaaccttggtgcagctggcagtggtatgtcaaatattatgctaacttgtaactagtgtaaatttgatcattgttgagtttt |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||| || | |
|
|
| T |
16512809 |
cttgtctttcttgcgtgtgcaaccttggtgcagctggcagtggtatgtcaaatgttatgctaatttgtaactagtctaaatttgatcattgt----ttat |
16512904 |
T |
|
| Q |
199 |
ttaagtcctttactccacagttctgat |
225 |
Q |
| |
|
||||| |||||| | |||||||||||| |
|
|
| T |
16512905 |
ttaagacctttatttcacagttctgat |
16512931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University