View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13320_low_8 (Length: 287)
Name: NF13320_low_8
Description: NF13320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13320_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 4 - 276
Target Start/End: Complemental strand, 16512632 - 16512360
Alignment:
| Q |
4 |
gggggcgagtacttttctcatagcaattttataatttacacacaattgttcctgataattaacctgaagtggtgttccagttagacaccagcggcagtgt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16512632 |
gggggcgagtacttttctcatagcaattttataatttacacgcaattgttcctggtaattaacctgaagtggtgttccagttagacaccagcggcagtgc |
16512533 |
T |
 |
| Q |
104 |
gacgacagagcaatagcagcctcagcaacctggcttttatgggattttatatgatgagcttcgtctagcaccactctgtaccattggaccctgtggtaga |
203 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16512532 |
gacgatagagcaatagcagcctcagcaacctggcttttatgggattttatatgatgagcttcgtctagtaccactctgtaccattggaccctgtggtaga |
16512433 |
T |
 |
| Q |
204 |
tgctattctctctttcctggtttcagaaatcaggaaactcaatgtaaagaaacttcactgagcaaattaacga |
276 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||| ||||||| |||| |
|
|
| T |
16512432 |
tgctattctctctttcctggtttcaaaaaacaggaaacccaatgtaaagaaacttcactgtgcaaattgacga |
16512360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University