View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13322_high_7 (Length: 254)
Name: NF13322_high_7
Description: NF13322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13322_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 25899595 - 25899361
Alignment:
| Q |
18 |
ttgacggtaagcacaactatctcttattgcatagccttatttcctgatcttcatattgatt----agtgacctgtgatggttaagtttttttatcgccan |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25899595 |
ttgatggtaagcacaactatctcttattgcatagccttatttcctgatcttcatattgattgattagtgacctgtgatggttaagtttttttatcgccat |
25899496 |
T |
 |
| Q |
114 |
nnnnnnnnnnnnn----gcatactaatttccctagattgtgtgattatgaaaggttaaacttgaaatgagaatgggcaaggtcctgatacattgatttgc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25899495 |
ggtttttttttttttttgcatactaatttccctagattgtgtgattatgaaaggttaaacttgaaatgagaatgggcaaggtcctgatacattgatttgc |
25899396 |
T |
 |
| Q |
210 |
ttcaatccttctgtcgatcttaaggacatgatgat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25899395 |
ttcaatccttctgtcgatcttaaggacatgatgat |
25899361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 184
Target Start/End: Complemental strand, 37616781 - 37616724
Alignment:
| Q |
127 |
gcatactaatttccctagattgtgtgattatgaaaggttaaacttgaaatgagaatgg |
184 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37616781 |
gcatactattttccctagattgtgtgattatggaaggttaaacttgaaatgagaatgg |
37616724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 92; Significance: 9e-45; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 29200018 - 29200132
Alignment:
| Q |
127 |
gcatactaatttccctagattgtgtgattatgaaaggttaaacttgaaatgagaatgggcaaggtcctgatacattgatttgcttcaatccttctgtcga |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
29200018 |
gcatactaatttccctagattgtgtgattatgaaaggttaaacctgaaatgagaat-gacaaggtcctgatacattgattttcttcaatgcttctgtcga |
29200116 |
T |
 |
| Q |
227 |
tcttaaggacatgatg |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29200117 |
tcttaaggacatgatg |
29200132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 18 - 104
Target Start/End: Original strand, 40068667 - 40068753
Alignment:
| Q |
18 |
ttgacggtaagcacaactatctcttattgcatagccttatttcctgatcttcatattgattagtgacctgtgatggttaagtttttt |
104 |
Q |
| |
|
|||| |||||||||| |||||||||||| |||| |||||||||||| || ||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
40068667 |
ttgatggtaagcacagctatctcttatttcataaccttatttcctgctcctcatattgattggtgaccggtgatggttaagtttttt |
40068753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 184
Target Start/End: Original strand, 19768506 - 19768563
Alignment:
| Q |
127 |
gcatactaatttccctagattgtgtgattatgaaaggttaaacttgaaatgagaatgg |
184 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
19768506 |
gcatactattttccctagattgtttgattatggaaggttaaacttgaaatgagaatgg |
19768563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University