View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13322_low_9 (Length: 326)
Name: NF13322_low_9
Description: NF13322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13322_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 24 - 312
Target Start/End: Complemental strand, 26833895 - 26833606
Alignment:
| Q |
24 |
gcttagatcttcaagcatatcaacgttttgttaatttttctacctcttccacagtttcttttctgcatgaccc-tggaaacaaaaacaagtttttctcct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26833895 |
gcttagatcttcaagcatatcaacgttttgttaatttttctacctctttcacagtttcttttctgcatgacccctggaaacaaaaacaagtttttctcct |
26833796 |
T |
|
| Q |
123 |
tttctttaagtaaagttggttaaatttattcnnnnnnncatttgaagtnnnnnnntgtatgcttttcaaggagcaaggaatggacttggtttacaactcg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26833795 |
tttctttaagtaaagttggttaaatttattcaaaaaaacatttgaagtaaaaaaatgtatgcttttcaaggagcaaggaatggacttggtttacaacacg |
26833696 |
T |
|
| Q |
223 |
agtttcgttggagacaaatcagagagccattgatcgtgccattgctgagagttgcagtgtttctttgcctaggcatgtcgttgatgatgt |
312 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26833695 |
agtttctttggagacaaatcagagagccattgatcgtgccattgctgagagttgcagtgtttgtttgcctaggcatgtcgttgatgatgt |
26833606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 238 - 310
Target Start/End: Complemental strand, 26786891 - 26786819
Alignment:
| Q |
238 |
aaatcagagagccattgatcgtgccattgctgagagttgcagtgtttctttgcctaggcatgtcgttgatgat |
310 |
Q |
| |
|
|||| ||||| || |||||||||||| ||||||||| |||||||||| | |||||| ||||||| |||||||| |
|
|
| T |
26786891 |
aaataagagaacctttgatcgtgccaatgctgagagctgcagtgtttatctgcctaagcatgtcattgatgat |
26786819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University