View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13323_high_3 (Length: 419)
Name: NF13323_high_3
Description: NF13323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13323_high_3 |
 |  |
|
| [»] scaffold0771 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 1e-63; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 17 - 148
Target Start/End: Complemental strand, 12033004 - 12032873
Alignment:
| Q |
17 |
aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgcaaacaaattggca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12033004 |
aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactctcaattttagggagggtaaccattgtgcaaacaaattggca |
12032905 |
T |
 |
| Q |
117 |
gacattggcttttctattcaatctcaattttg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12032904 |
gacattggcttttctattcaatctcaattttg |
12032873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 17 - 150
Target Start/End: Original strand, 14636683 - 14636816
Alignment:
| Q |
17 |
aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgcaaacaaattggca |
116 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14636683 |
aagaaataggtggcaaaaatgcttgaaactttgctcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgcagacaaattggca |
14636782 |
T |
 |
| Q |
117 |
gacattggcttttctattcaatctcaattttggt |
150 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
14636783 |
gacattggtttttctattcaatctcaattttggt |
14636816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 315 - 408
Target Start/End: Original strand, 13949670 - 13949763
Alignment:
| Q |
315 |
ctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcatactctccctcgacgagaata |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13949670 |
ctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcatactcttcctcgacgagaata |
13949763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 315 - 408
Target Start/End: Original strand, 20899905 - 20899998
Alignment:
| Q |
315 |
ctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcatactctccctcgacgagaata |
408 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20899905 |
ctttacctttttgtggttagttttggtgccgggtgctcccaactcctgtctgatatgcaggctttcaaggtcatactctccctcgacgagaata |
20899998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 150 - 233
Target Start/End: Complemental strand, 12032848 - 12032765
Alignment:
| Q |
150 |
tatatgggattatgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc |
233 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12032848 |
tatatgggattatgctaaaaatagattaggtttacctctttttaggttttgttatccttgagggtcaggttcttgtcccccctc |
12032765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 150 - 233
Target Start/End: Original strand, 14636839 - 14636921
Alignment:
| Q |
150 |
tatatgggattatgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc |
233 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14636839 |
tatatgggattatgctataaatag-ttgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc |
14636921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 257 - 296
Target Start/End: Complemental strand, 12032741 - 12032702
Alignment:
| Q |
257 |
attatcaatctaatgggacttgtctgttgacaagtttcct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12032741 |
attatcaatctaatgggacttgtctgttgacaagtttcct |
12032702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0771 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: scaffold0771
Description:
Target: scaffold0771; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 315 - 408
Target Start/End: Original strand, 1810 - 1903
Alignment:
| Q |
315 |
ctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcatactctccctcgacgagaata |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1810 |
ctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcatactcttcctcgacgagaata |
1903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 1e-26; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 152 - 233
Target Start/End: Complemental strand, 8294962 - 8294881
Alignment:
| Q |
152 |
tatgggattatgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc |
233 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
8294962 |
tatgggactttgctagaaatagattgggtttacctctttttaggttttgttagccttaagggtcaggtgcttgtcccccctc |
8294881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 162 - 231
Target Start/End: Original strand, 27727847 - 27727916
Alignment:
| Q |
162 |
tgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccc |
231 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
27727847 |
tgctagaaatagattgggtttacctatttttaggttttgttagccttgagggtcaggtgcttgtcccccc |
27727916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 17 - 135
Target Start/End: Complemental strand, 8295120 - 8295002
Alignment:
| Q |
17 |
aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgcaaacaaattggca |
116 |
Q |
| |
|
||||||||| |||||||| || || || || || ||||||| |||||| ||||||||||| |||| |||||| ||||| |||||||| ||||| | ||| |
|
|
| T |
8295120 |
aagaaatagatggcaaaattgttttcatctctgctcctctatgtctttttttgtaactcatatttatagggaaggtaatcattgtgctgacaaactagca |
8295021 |
T |
 |
| Q |
117 |
gacattggcttttctattc |
135 |
Q |
| |
|
|| ||||| |||||||||| |
|
|
| T |
8295020 |
gatattggtttttctattc |
8295002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 103
Target Start/End: Original strand, 27727679 - 27727765
Alignment:
| Q |
17 |
aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgc |
103 |
Q |
| |
|
||||||||| |||||||| || | || || || ||||||| |||||| ||||||||||| |||| |||||| ||||| |||||||| |
|
|
| T |
27727679 |
aagaaatagatggcaaaattgtcttcatctctgctcctctatgtctttttttgtaactcatatttatagggaaggtaatcattgtgc |
27727765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 60; Significance: 2e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 162 - 233
Target Start/End: Complemental strand, 22162122 - 22162051
Alignment:
| Q |
162 |
tgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc |
233 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
22162122 |
tgctagaaatagattgggtttacctatttttaggttttgttagccttgagggtcaggtgcttgtcccccctc |
22162051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 17 - 135
Target Start/End: Complemental strand, 22162290 - 22162172
Alignment:
| Q |
17 |
aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgcaaacaaattggca |
116 |
Q |
| |
|
||||||||| |||||||| || | || || || ||||||| |||||| ||||||||||| |||| |||||| ||||| |||||||| ||||| | ||| |
|
|
| T |
22162290 |
aagaaatagatggcaaaattgtattcatctctgctcctctatgtctttttttgtaactcatatttatagggaaggtaatcattgtgctgacaaactagca |
22162191 |
T |
 |
| Q |
117 |
gacattggcttttctattc |
135 |
Q |
| |
|
|| ||||| |||||||||| |
|
|
| T |
22162190 |
gatattggtttttctattc |
22162172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 98
Target Start/End: Original strand, 6642985 - 6643037
Alignment:
| Q |
46 |
tttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccat |
98 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||| | ||||||||| |||||| |
|
|
| T |
6642985 |
tttgttcctctatgtctttctttgtaactcgcatctatagggaggggaaccat |
6643037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 323 - 387
Target Start/End: Original strand, 40700883 - 40700947
Alignment:
| Q |
323 |
ttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtca |
387 |
Q |
| |
|
|||| |||||||||||||||| || ||||| ||||| || || ||||||||||| |||||||||| |
|
|
| T |
40700883 |
ttttgtggtcagtgttggtgctggctgctcgcaactgctctcagatatgcaggctttcaaggtca |
40700947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University