View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13323_low_3 (Length: 419)

Name: NF13323_low_3
Description: NF13323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13323_low_3
NF13323_low_3
[»] chr3 (7 HSPs)
chr3 (17-148)||(12032873-12033004)
chr3 (17-150)||(14636683-14636816)
chr3 (315-408)||(13949670-13949763)
chr3 (315-408)||(20899905-20899998)
chr3 (150-233)||(12032765-12032848)
chr3 (150-233)||(14636839-14636921)
chr3 (257-296)||(12032702-12032741)
[»] scaffold0771 (1 HSPs)
scaffold0771 (315-408)||(1810-1903)
[»] chr7 (4 HSPs)
chr7 (152-233)||(8294881-8294962)
chr7 (162-231)||(27727847-27727916)
chr7 (17-135)||(8295002-8295120)
chr7 (17-103)||(27727679-27727765)
[»] chr1 (2 HSPs)
chr1 (162-233)||(22162051-22162122)
chr1 (17-135)||(22162172-22162290)
[»] chr8 (1 HSPs)
chr8 (46-98)||(6642985-6643037)
[»] chr5 (1 HSPs)
chr5 (323-387)||(40700883-40700947)


Alignment Details
Target: chr3 (Bit Score: 124; Significance: 1e-63; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 17 - 148
Target Start/End: Complemental strand, 12033004 - 12032873
Alignment:
17 aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgcaaacaaattggca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||    
12033004 aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactctcaattttagggagggtaaccattgtgcaaacaaattggca 12032905  T
117 gacattggcttttctattcaatctcaattttg 148  Q
    ||||||||||||||||||||||||||||||||    
12032904 gacattggcttttctattcaatctcaattttg 12032873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 17 - 150
Target Start/End: Original strand, 14636683 - 14636816
Alignment:
17 aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgcaaacaaattggca 116  Q
    |||||||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
14636683 aagaaataggtggcaaaaatgcttgaaactttgctcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgcagacaaattggca 14636782  T
117 gacattggcttttctattcaatctcaattttggt 150  Q
    |||||||| |||||||||||||||||||||||||    
14636783 gacattggtttttctattcaatctcaattttggt 14636816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 315 - 408
Target Start/End: Original strand, 13949670 - 13949763
Alignment:
315 ctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcatactctccctcgacgagaata 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
13949670 ctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcatactcttcctcgacgagaata 13949763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 315 - 408
Target Start/End: Original strand, 20899905 - 20899998
Alignment:
315 ctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcatactctccctcgacgagaata 408  Q
    |||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
20899905 ctttacctttttgtggttagttttggtgccgggtgctcccaactcctgtctgatatgcaggctttcaaggtcatactctccctcgacgagaata 20899998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 150 - 233
Target Start/End: Complemental strand, 12032848 - 12032765
Alignment:
150 tatatgggattatgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc 233  Q
    ||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
12032848 tatatgggattatgctaaaaatagattaggtttacctctttttaggttttgttatccttgagggtcaggttcttgtcccccctc 12032765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 150 - 233
Target Start/End: Original strand, 14636839 - 14636921
Alignment:
150 tatatgggattatgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc 233  Q
    ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14636839 tatatgggattatgctataaatag-ttgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc 14636921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 257 - 296
Target Start/End: Complemental strand, 12032741 - 12032702
Alignment:
257 attatcaatctaatgggacttgtctgttgacaagtttcct 296  Q
    ||||||||||||||||||||||||||||||||||||||||    
12032741 attatcaatctaatgggacttgtctgttgacaagtttcct 12032702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0771 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: scaffold0771
Description:

Target: scaffold0771; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 315 - 408
Target Start/End: Original strand, 1810 - 1903
Alignment:
315 ctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcatactctccctcgacgagaata 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
1810 ctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcatactcttcctcgacgagaata 1903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 62; Significance: 1e-26; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 152 - 233
Target Start/End: Complemental strand, 8294962 - 8294881
Alignment:
152 tatgggattatgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc 233  Q
    ||||||| | |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||||    
8294962 tatgggactttgctagaaatagattgggtttacctctttttaggttttgttagccttaagggtcaggtgcttgtcccccctc 8294881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 162 - 231
Target Start/End: Original strand, 27727847 - 27727916
Alignment:
162 tgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccc 231  Q
    ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||    
27727847 tgctagaaatagattgggtttacctatttttaggttttgttagccttgagggtcaggtgcttgtcccccc 27727916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 17 - 135
Target Start/End: Complemental strand, 8295120 - 8295002
Alignment:
17 aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgcaaacaaattggca 116  Q
    ||||||||| |||||||| || || || || || ||||||| |||||| ||||||||||| |||| |||||| ||||| ||||||||  ||||| | |||    
8295120 aagaaatagatggcaaaattgttttcatctctgctcctctatgtctttttttgtaactcatatttatagggaaggtaatcattgtgctgacaaactagca 8295021  T
117 gacattggcttttctattc 135  Q
    || ||||| ||||||||||    
8295020 gatattggtttttctattc 8295002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 17 - 103
Target Start/End: Original strand, 27727679 - 27727765
Alignment:
17 aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgc 103  Q
    ||||||||| |||||||| ||  | || || || ||||||| |||||| ||||||||||| |||| |||||| ||||| ||||||||    
27727679 aagaaatagatggcaaaattgtcttcatctctgctcctctatgtctttttttgtaactcatatttatagggaaggtaatcattgtgc 27727765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 60; Significance: 2e-25; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 162 - 233
Target Start/End: Complemental strand, 22162122 - 22162051
Alignment:
162 tgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc 233  Q
    ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||    
22162122 tgctagaaatagattgggtttacctatttttaggttttgttagccttgagggtcaggtgcttgtcccccctc 22162051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 17 - 135
Target Start/End: Complemental strand, 22162290 - 22162172
Alignment:
17 aagaaataggtggcaaaactgcttgcaactttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccattgtgcaaacaaattggca 116  Q
    ||||||||| |||||||| ||  | || || || ||||||| |||||| ||||||||||| |||| |||||| ||||| ||||||||  ||||| | |||    
22162290 aagaaatagatggcaaaattgtattcatctctgctcctctatgtctttttttgtaactcatatttatagggaaggtaatcattgtgctgacaaactagca 22162191  T
117 gacattggcttttctattc 135  Q
    || ||||| ||||||||||    
22162190 gatattggtttttctattc 22162172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 98
Target Start/End: Original strand, 6642985 - 6643037
Alignment:
46 tttgttcctctaggtctttctttgtaactcacatttttagggagggtaaccat 98  Q
    |||||||||||| ||||||||||||||||| ||| | ||||||||| ||||||    
6642985 tttgttcctctatgtctttctttgtaactcgcatctatagggaggggaaccat 6643037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 323 - 387
Target Start/End: Original strand, 40700883 - 40700947
Alignment:
323 ttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtca 387  Q
    |||| |||||||||||||||| || ||||| ||||| || || ||||||||||| ||||||||||    
40700883 ttttgtggtcagtgttggtgctggctgctcgcaactgctctcagatatgcaggctttcaaggtca 40700947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University