View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13324_high_2 (Length: 472)
Name: NF13324_high_2
Description: NF13324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13324_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 382; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 66 - 463
Target Start/End: Original strand, 35164386 - 35164783
Alignment:
| Q |
66 |
agaaaatgggaaagtgacgacgttaattgagaactggtttaagaataatgctaaaccagttaacgggacagaagttgctgaaacagatacagaaacggtt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35164386 |
agaaaatgggaaagtgacgacgttaattgagaactggtttaagaataatgctaaaccagttaacgggacagaagttgctgaaacagatacagaaacggtt |
35164485 |
T |
|
| Q |
166 |
gagatttcatcgtttcaatctctatccgcgttgttatggcgtgcaatcacgcgcgctaggaaatttcatccatccaaaacgacgacgtttagaatggcgg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35164486 |
gagatttcatcgtttcaatctctatccgcgttgttatggcgtgcaatcacgcgcgctaggaaatttcatccatccaaaacgacgacgtttagaatggcgg |
35164585 |
T |
|
| Q |
266 |
ttaattgtagacaccgtatagaaccgaagctagaagcgttttattttggaaacgcgattcagagtgttccaacctatgcttctccgctagatgtaatgtc |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||| |
|
|
| T |
35164586 |
ttaattgtagacaccgtatagaaccgaagctagaagcgttttattttggaaacgcgattcagagtgttccaacttatgcttctgcgggagatgtaatgtc |
35164685 |
T |
|
| Q |
366 |
tagggatatacggtggtgtgcgatgcagctgaataaaaacgtgaaggcacatgataatggtatggtgaggaggtttgtagaggattgggagaataatc |
463 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35164686 |
tagggatatacggtggtgtgcgatgcagctgaataaaaacgtgaaggcacatgataatggtatggtgaggaggtttgtagaggattgggagaataatc |
35164783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 35164336 - 35164370
Alignment:
| Q |
1 |
attgaattgatgcagaaacacatgaacgatcacta |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35164336 |
attgaattgatgcagaaacacatgaacgatcacta |
35164370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University