View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13325_high_3 (Length: 271)
Name: NF13325_high_3
Description: NF13325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13325_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 39224820 - 39224655
Alignment:
| Q |
18 |
agaagaaataaagaataaggtgtgacttgcatgtatgtgttcatgttggctaggtgttaatttttcctaactagctagtttgtgttatttgaaaattttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39224820 |
agaagaaataaagaataaggtgtgacttgtatctatgtgttcatgttggctaggtgttaatttt-cctaactagctagtttgtgttatttgagaattttg |
39224722 |
T |
 |
| Q |
118 |
aagattttgtttaactatttattagctagagttggacctgttcnnnnnnntaaaactatagttggta |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39224721 |
aagattttgtttaactatttattagctagagttggacctgttcaaaaaaataaaactatagttggta |
39224655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University