View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13325_low_5 (Length: 205)
Name: NF13325_low_5
Description: NF13325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13325_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 25 - 186
Target Start/End: Complemental strand, 14983905 - 14983754
Alignment:
| Q |
25 |
tagtcgttgagttttatgttttttattgtgtcttgttactgttaaaacactttgaatgacgtgatgtcaatgtggacaagccacaatgtcacttaatgtg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14983905 |
tagtcgttgagttttatgttttttattgtgtcttgttactgttaaaacactttgtatgacgtgatgtcaatgtggacaagccacaatgtc---------- |
14983816 |
T |
|
| Q |
125 |
acatgccaaaacctttaacatgattatttgatggattgaatttttagtatttagtatatttg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14983815 |
acatgccaaaacctttaacatgattatttgatggattgaatttttagtatttagtatatttg |
14983754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University