View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13326_low_9 (Length: 269)
Name: NF13326_low_9
Description: NF13326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13326_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 13 - 252
Target Start/End: Complemental strand, 35603439 - 35603200
Alignment:
| Q |
13 |
aatatccaagtctcccttccatggtggggcatattaagaagaccacttttgcttacctaaaacgtagaatttgtaaataagtgtcaattttgaagtgttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603439 |
aatatccaagtctcccttccatggtggggcatattaagaagaccactttcgcttacctaaaacgtagaatttgtaaataagtgtcaattttgaagtgttg |
35603340 |
T |
|
| Q |
113 |
gattctttctcgcgttggaaagaaaatcttaattaaatctgttactcaggaatcatgccgtatatgtatggatcttctcaaggaaccctatatcatgcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603339 |
gattctttctcgcgttggaaagaaaatcttaattaaatctgttactcaggaatcatgccgtatatgtatggatcttctcaaggaaccctatatcatgcaa |
35603240 |
T |
|
| Q |
213 |
agtatcactcacatgagtatcatatgaaatttgatgattt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603239 |
agtatcactcacatgagtatcatatgaaatttgatgattt |
35603200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University