View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13327_high_4 (Length: 384)
Name: NF13327_high_4
Description: NF13327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13327_high_4 |
 |  |
|
| [»] scaffold1113 (2 HSPs) |
 |  |  |
|
| [»] scaffold0961 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 1e-75; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 28 - 175
Target Start/End: Original strand, 32684079 - 32684226
Alignment:
| Q |
28 |
cagagataggggaatttgacatgaaggtgtgtggatatcattgtaagaatctcaaatttggtcgaagataaattgtagacgcatgaatgagccggatgct |
127 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684079 |
cagagatagggaaatttgacatgaaggtgtgtggatatcattgtaagaatctcaaatttggtcgaagataaattgtagacgcatgaatgagccggatgct |
32684178 |
T |
 |
| Q |
128 |
gatttagcattcaaggcaagtttttctctaacaataattttgattcta |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684179 |
gatttagcattcaaggcaagtttttctctaacaataattttgattcta |
32684226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 233 - 361
Target Start/End: Original strand, 32684284 - 32684412
Alignment:
| Q |
233 |
cctctaaaccagcagatctggcagttgaattgtgcgctgaaatccaaggctgaatataaagaggaggttgacaatgaccgtaaagaacttcgaagcacaa |
332 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684284 |
cctctaaaccagcagatctggcagctgaattgtgcgctgaaatccaaggctgaatataaagaggaggttgacaatgaccgtaaagaacttcgaagcacaa |
32684383 |
T |
 |
| Q |
333 |
gacctcattgcgttatattgtgatagtca |
361 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
32684384 |
gacctcattgcgttatattttgatagtca |
32684412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 233 - 327
Target Start/End: Original strand, 32692182 - 32692276
Alignment:
| Q |
233 |
cctctaaaccagcagatctggcagttgaattgtgcgctgaaatccaaggctgaatataaagaggaggttgacaatgaccgtaaagaacttcgaag |
327 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32692182 |
cctctaaaccagcagatctggcagctgaattgtgtgctgaaatgcaaggttgaatataaagaggaggttgacaatgaccgtaaagaactttgaag |
32692276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 290 - 359
Target Start/End: Complemental strand, 32560082 - 32560013
Alignment:
| Q |
290 |
aaagaggaggttgacaatgaccgtaaagaacttcgaagcacaagacctcattgcgttatattgtgatagt |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32560082 |
aaagaggaggttgacaatgaccgtaaagaacttcgaagcacaagacctcgttgcgttatattgtgatagt |
32560013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 175
Target Start/End: Original strand, 32692090 - 32692124
Alignment:
| Q |
141 |
aggcaagtttttctctaacaataattttgattcta |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32692090 |
aggcaagtttttctctaacaataattttgattcta |
32692124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: scaffold1113
Description:
Target: scaffold1113; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 102 - 175
Target Start/End: Complemental strand, 134 - 61
Alignment:
| Q |
102 |
gtagacgcatgaatgagccggatgctgatttagcattcaaggcaagtttttctctaacaataattttgattcta |
175 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
134 |
gtagacgcgtgaatgagccggatgctgatttagcattcgaggcaagtttttctctaacaataattttgattcta |
61 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 173
Target Start/End: Complemental strand, 1904 - 1872
Alignment:
| Q |
141 |
aggcaagtttttctctaacaataattttgattc |
173 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
1904 |
aggcaagtttttctctaacaatgattttgattc |
1872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0961 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0961
Description:
Target: scaffold0961; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 173
Target Start/End: Original strand, 1713 - 1745
Alignment:
| Q |
141 |
aggcaagtttttctctaacaataattttgattc |
173 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
1713 |
aggcaagtttttctctaacaatgattttgattc |
1745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University