View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13327_low_6 (Length: 222)
Name: NF13327_low_6
Description: NF13327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13327_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 5 - 204
Target Start/End: Original strand, 20688156 - 20688355
Alignment:
| Q |
5 |
tcaagtaggatatataatatgtttcacactgttttgcttttatcagaaggagttcctttgtattatggtaagggttctgaagctatggaatatttctctg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20688156 |
tcaagtaggatatataatatgtttcacactgttttgattttatcagaaggagttcctttgtattatggaaagggttctgaagctatggaatatttctctg |
20688255 |
T |
|
| Q |
105 |
gtattggatatgaacctgaaattgccatgaacccatctgatttccttttggatcttgcaaatggtatgttactccttgttctatttatttagcaaagttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20688256 |
gtattggatatgaacctgaaattgccatgagcccatctgatttccttttggatcttgcaaatggtatgttactccttgttctatttatttagcaaagttt |
20688355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 174
Target Start/End: Original strand, 33718810 - 33718923
Alignment:
| Q |
61 |
tttgtattatggtaagggttctgaagctatggaatatttctctggtattggatatgaacctgaaattgccatgaacccatctgatttccttttggatctt |
160 |
Q |
| |
|
|||||||| ||| || || ||||||||||| ||| |||| || |||||| |||| |||| || || ||||| || || |||||||||||||||||| |
|
|
| T |
33718810 |
tttgtattttggaaaagggtctgaagctattgaacattttactaatattggttatgctcctgctatggctatgaatccttcagatttccttttggatctt |
33718909 |
T |
|
| Q |
161 |
gcaaatggtatgtt |
174 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33718910 |
gcaaatggtatgtt |
33718923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University