View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13329_low_9 (Length: 218)
Name: NF13329_low_9
Description: NF13329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13329_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 56 - 195
Target Start/End: Complemental strand, 29967738 - 29967599
Alignment:
| Q |
56 |
gctccgagtcctttgggtttatttgactcactccctcctgaaatactcctcaaaatcacaagactattaagccctaaacatgctgccaaactctgcctcg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29967738 |
gctccgagtcctttgggtttatttgactcactccctcctgacatactcctcaaaatcacaagactattaggccctaaacatgctgccaaactctgcctcg |
29967639 |
T |
 |
| Q |
156 |
tttgcaagtcatggcgatctctcgtctccgataacgaact |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29967638 |
tttgcaagtcatggcgatctctcgtctccgataacgaact |
29967599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University