View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1332_high_22 (Length: 219)
Name: NF1332_high_22
Description: NF1332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1332_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 26 - 198
Target Start/End: Original strand, 5781888 - 5782060
Alignment:
| Q |
26 |
ggaggagcagagacttaagttagattcgagagtgaagatgacggagtcaggacttgtatcgccgccgccggtgacggtgttggcggtggtgttgcgtgtt |
125 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5781888 |
ggaggagaagagacttaagttagattcgagagtgaagatgacggagtcaggacttgtatcgccgccgccggtgacggtgttggcggtggtgttgcgtgtt |
5781987 |
T |
 |
| Q |
126 |
cttgaaccggtgttacgcctccacgaacgtcgttgttcgtgaaaccctaaatcacgcattgttaacaaacatc |
198 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5781988 |
cttgaaccggtgttacgcctccacgagcgtcgttgttcgtgaaaccctaaatcacgcattgttaacaaacatc |
5782060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University